Kit 1
Validated kit:
  • Kit has been validated in situ by the Molecular Instruments Team.
  • Serves as positive control.
  • Orders ship within approximately 2 business days.
Custom kit:
  • Probe set synthesized from scratch.
  • Orders ship within approximately 10 business days. Kits selected from the library will ship within approximately 2 business days.
Target Tpm3 Accession number NM_201492
mRNA Sequence
GAACACUAUUAGCUAUUUGUAGUACUCUAAAGAGGACUGCAGAACGCAUCGCAGUAGUGGUGAAAAGCCG
UGCGUGCGCGUGAAACAUCUGAUCCUCACGUUACUUCCACUCGCUCUGCGUUUGACUUGUUGGCGGGGCG
UUGGUGCCUUGGACUUUUUUUUCCUCCUUCUCUUCUUCGCGGCUCGGUCCACUACGCUGCUCGAGAGGAA
UCUGCUUUAUUCGACCACACUACUCCUAAAGUAACACAUUAAAAUGGCCGGAUCAAACAGCAUCGAUGCA
GUUAAGAGAAAAAUCAAAGUUUUACAACAGCAAGCAGAUGAGGCAGAAGAAAGAGCCGAGAUUUUGCAGA
GACAGGUCGAGGAGGAGAAGCGUGCCAGGGAGCAGGCUGAGGCAGAGGUGGCUUCUCUGAACAGGCGUAU
CCAGCUGGUUGAGGAGGAGUUGGAUCGUGCUCAGGAGAGACUGGCCACAGCCCUGCAAAAGCUGGAGGAA
GCCGAGAAGGCCGCAGAUGAGAGCGAGAGAGGGAUGAAGGUGAUUGAGAACAGGGCUCUGAAGGAUGAGG
AGAAGAUGGAGCUGCAGGAGAUCCAGCUUAAGGAGGCCAAGCACAUUGCUGAGGAGGCUGACCGCAAAUA
UGAAGAGGUGGCUCGUAAGCUGGUGAUCGUUGAGGGAGAGUUGGAGCGUACAGAGGAGAGAGCAGAGCUU
GCAGAGAGCCAUGUCAAGCAGAUGGAGGAGGAGCUGAGAGCUCUUGACCAGACACUGAAGACUCUUCAGG
CCUCAGAGGAGAAGUAUUCCCAGAAGGAGGACAAGUAUGAGGAAGAAAUCAAGAUCCUCACUGAUAAGCU
GAAGGAGGCUGAGACCCGUGCAGAGUUUGCUGAGAGGUCUGUGGCCAAACUGGAGAAAACCAUUGAUGAU
UUGGAAGAGAAACUGAGAGAUGCUAAAGAGGAGAACAUCAAGAUCCAUGCUACUUUGGACCAGACCCUGA
GCGAGCUCAAUAGUUUCUAAAGAAGACCUGGAGCAGAAAAAAGGCCUUUUCUUCCCUUCUUGACUCCCUC
AUCUCAUUUUGGUUUCUUUGUCUCUGCACAUCUGAUUCUCCCCCUUUUUUUUUCUUCUCUUCUUCUGCUG
GAGGAUAAGCUCACCAAGCCAACCAGCAAAAAUGUGGUGCCUCUCAAUUUUUCCAAACUACUAUUCCAAG
UGAUUUGAGAAAUGAUCUACUACGAUACUCCUCAAGAGUCAAAUGUUGACCUCGGGGAGCCUUUUUUGGU
AUUGCUCCAUGAUCAGAGCUUUACGAGCUAGUGUUUUUUCUGCAUAUCAGCCCAAACUCUCAAUGAUAAU
UUUACUGGAGGCUGAUUUUUGUAAAAUUUUGUGCCAUAAAAGCCUUGUUGGCUUGUCUCUUGCUUGGCUU
UAGAUCAUUCUCAAGCCAUUUUUUUCCUGCUGUUGCUCUGACACAGGUUGUUUUUGCUGGUCUUGUUGGU
GCCUGAUCCACUGCUAUCCUUUUCACACCUCUUUUUUUUUUUUCUUCAUCCUGCACAAGUUUCUGCUGCC
UGUUAGUCGGCAUCACCGGUUUUGGGACCAAAACCACAUCAUGUGGUCUGUAACAGUAUGCACAACCAUG
CCGUGAGGACCAAAUUUGUUUUAUUAUUGUUAUUAUUAUUAAAAGCCUUUGCUUCCAUUCGGAGUUUGUU
UUUUUGAGUAAUAUAUGUAUUCAUUGUUUGGGUCGAAUCCCCUUGCUUUUUUAACACAAAUGUUUUGCAA
ACCACUAUUUGAAAUGGUGCACUGUUAUGGGCUUAUGGUGAGCAGAUGAGGCCAAGUCAUGGUUUCUUCA
UUAUAAUUUUCUUUUCAUUUGCUUUAAAGAGCCAUAUUCUACCCAGGGAAGAAAGGUUGAAGUUGUUUUG
UUUUUUUACCGUGAGUUCAAAGCAGUGGCACUGCCAGAUUUAAAAGGUUCAAAAGCCGUGCAGAUCUAAA
AUAUGUAUUAUGAACACAGUAAUGGGAGCGAAUUGUAACACUUAAUAGUAUACAAAUUUAAGAAACAGGG
GUGAACACAUAGUUUUAACUGGAAAAAGCCCACAAUGAUGUGUAAUCACUUUGUUACUGUCUGUAUCUUG
UGUAAUGAUACCUAAAUUCUUUUUUUAAAUAAAAACCAUGAUUUUUACUGUCACUGAAAAAAAAAAAAAA
AAAAA
Number of probes 5
Select the number of probes in the probe set.
  • Validated kits: number of probes is fixed.
  • Custom kits: the number of probes is restricted only by the length of the target. We recommend starting with approximately five probes in a probe set (see FAQ).
Probe scale
Different model systems require different scales of probe synthesis. 20 experiments require approximately:
  • 20 pmole for zebrafish
  • 40 pmole for chick
  • 1 pmole for bacteria smeared in a 6 mm well on a teflon-coated slide
  • 4 pmole for a tissue section on a slide.
Amplifier
Amplifier selection is restricted for validated kits.
Amplifier scale
Different model systems require different scales of HCR amplifier. Typically, the amplifier scale should be 30x the probe scale. 20 experiments require approximately:
  • 600 pmole for zebrafish
  • 1200 pmole for chick
  • 30 pmole for bacteria smeared in a 6 mm well on a teflon-coated slide
  • 120 pmole for a tissue section on a slide.
Fluorophore
Select the fluorophore for this amplifier.
Fluorophore selection is restricted for validated kits.
Hybridization buffers
Different model systems require different amounts of hybridization buffer (HB). 20 experiments require approximately:
  • 35 mL for zebrafish
  • 240 mL for chick
  • 1 mL for bacteria smeared in a 6 mm well on a teflon-coated slide
  • 6 mL for a tissue section on a slide.
An order for 20 mL of hybridization buffer includes:
  • 20 mL of hybridization buffer for probe hybridization
  • 20 mL of wash buffer for probe washes
  • 20 mL of amplification buffer for HCR in situ amplification.
Comment
Subtotal: 350.00
Total (USD): 350.00